9.3 A dot plot provides a straightforward way to identifysimilar regions in pairs of sequences. In a dot plot, onesequence is written along the X-axis on a sheet of graph paper, and the second sequence is written along the Yaxis. A dot is placed in the plot whenever the nucleotidein a column on the X-axis matches the nucleotide in a row on the Y-axis.a. Construct a dot plot for each of the following pairs ofsequences, and then state where the plot reveals regionsof similarity between each pair of sequences.i. GCATTTAGAGCCCTAGTCGTGACAGATTCAGTTAGAGCCCTAGCTGATTGCii. AGCGATTGGTCCTGTACGAGCTAAGATGCACCTGTACGAGCCTTAb. Consider the results of your dot plots. What are someof the issues that the BLAST program, which performssequence similarity searches between a querysequence and sequences in a database, must address?

Then try StudyFetch, the AI-powered platform that can answer your questions and teach you more about it!